Human Josephin 2 (JOSD2) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	JOSD2
Locus ID	126119
Kit Components	GA114916G1, Josephin 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCCGACGGAAGTTGTAGTG GA114916G2, Josephin 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCCCACGGGAGTCGTAGTC GA114916G3, Josephin 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGGCCCTTCTTTCGCATA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001270639, NM_001270640, NM_001270641, NM_001270686, NM_138334
Synonyms	SBBI54
Summary	This gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.