Human TA1 (TAAR1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TAAR1
Locus ID	134864
Kit Components	GA115239G1, TA1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTAACCTGATTATGGATTT GA115239G2, TA1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGATAAATCAACACACAAA GA115239G3, TA1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGATAAATCAACACACAAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_138327
Synonyms	TA1; TAR1; TRAR1
Summary	The protein encoded by this gene is a G-protein coupled receptor activated by trace amines. The encoded protein responds little or not at all to dopamine, serotonin, epinephrine, or histamine, but responds well to beta-phenylethylamine, p-tyramine, octopamine, and tryptamine. While primarily functioning in neurologic systems, there is evidence that this gene is involved in blood cell and immunologic functions as well. This gene is thought to be intronless. [provided by RefSeq, Nov 2015]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.