Human BORIS (CTCFL) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CTCFL
Locus ID	140690
Kit Components	GA115390G1, BORIS gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCCCTCCCCTAGGTGTCAC GA115390G2, BORIS gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGAGGGGGGTGGTGGGTAA GA115390G3, BORIS gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGGGTAGGAGGGCCAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001269040, NM_001269041, NM_001269042, NM_001269043, NM_001269044, NM_001269045, NM_001269046, NM_001269047, NM_001269048, NM_001269049, NM_001269050, NM_001269051, NM_001269052, NM_001269054, NM_001269055, NM_080618, NR_072975
Synonyms	BORIS; CT27; CTCF-T; dJ579F20.2; HMGB1L1
Summary	CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.