Human PIGBOS1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PIGBOS1
Locus ID	101928527
Kit Components	GA119487G1, PIGBOS1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCCTGGGTGTTGAAGTACA GA119487G2, PIGBOS1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACCTTGTACTTCAACACCC GA119487G3, PIGBOS1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCGTCCATCCATTAAGTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001308421, NM_001308422, NM_001308423
Summary	Plays a role in regulation of the unfolded protein response triggered by endoplasmic reticulum (ER) stress resulting from the presence of unfolded proteins in the ER lumen.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.