Mouse Gata2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Gata2
Locus ID	14461
Kit Components	GA201552G1, Gata2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTGGGCCACTAGTCAGTCG GA201552G2, Gata2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTTCGACATCACTTCGAGG GA201552G3, Gata2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCTCAACCATAGCCGGTCT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_008090, NM_001355253
Synonyms	Gata-2
Summary	Transcriptional activator which regulates endothelin-1 gene expression in endothelial cells. Binds to the consensus sequence 5'-AGATAG-3'.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.