Mouse Lrp1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Lrp1
Locus ID	16971
Kit Components	GA202490G1, Lrp1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGGCTCGGGACCCCACTGAG GA202490G2, Lrp1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTAGAGCCGGTAGAGCCAA GA202490G3, Lrp1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCTACAAGCTTTGGAGTTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_008512
Synonyms	A2mr; AI316852; b2b1554Clo; CD91; Lrp
Summary	Endocytic receptor involved in endocytosis and in phagocytosis of apoptotic cells. Required for early embryonic development (PubMed:1423604). Involved in cellular lipid homeostasis. Involved in the plasma clearance of chylomicron remnants and activated LRPAP1 (alpha 2-macroglobulin), as well as the local metabolism of complexes between plasminogen activators and their endogenous inhibitors. May modulate cellular events, such as APP metabolism, kinase-dependent intracellular signaling, neuronal calcium signaling as well as neurotransmission. Acts as an alpha-2-macroglobulin receptor (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.