Mouse Stat6 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Stat6
Locus ID	20852
Kit Components	GA204128G1, Stat6 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACAGAGAAGAGAAAGTGGGC GA204128G2, Stat6 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGAGGAAGAGGAAGAAAG GA204128G3, Stat6 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTCCCCACCGGGTACATAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_009284
Summary	Carries out a dual function: signal transduction and activation of transcription. Involved in IL4/interleukin-4- and IL3/interleukin-3-mediated signaling.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.