Mouse Pnpla8 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Pnpla8
Locus ID	67452
Kit Components	GA207336G1, Pnpla8 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTGTTGGAGCTGAGTGCT GA207336G2, Pnpla8 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTGGGAGAGGCACCGCTT GA207336G3, Pnpla8 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCCCTATTACGTAGGCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_026164
Synonyms	1200006O19Rik; AI467579; Ipla2(gamma)
Summary	Calcium-independent phospholipase A2, which catalyzes the hydrolysis of the sn-2 position of glycerophospholipids, PtdSer and to a lower extent PtdCho. Cleaves membrane phospholipids (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.