Mouse Rbm20 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Rbm20
Locus ID	73713
Kit Components	GA209588G1, Rbm20 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCTAGTTGAATCTCTGAGC GA209588G2, Rbm20 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGGAGCATTGCTTGCTAAT GA209588G3, Rbm20 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGATACACCCCACTTGCCCA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001170847
Synonyms	1110018J23Rik; 2010003H22Rik; AI646761
Summary	RNA-binding protein that acts as a regulator of mRNA splicing of a subset of genes involved in cardiac development. Regulates splicing of TTN (Titin).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.