TOE1 Human Gene Knockout Kit (CRISPR)

CAT#: KN203377

TOE1 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


TOE1 (Myc-DDK-tagged)-Human target of EGR1, member 1 (nuclear) (TOE1)
    • 10 ug

CNY 3,800.00
CNY 4,560.00


TOE1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol TOE1
Locus ID 114034
Kit Components

KN203377G1, TOE1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AACTGCGCCATCGTCACTGT

KN203377G2, TOE1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GACGGTGAGCGGCTTCCCAG

KN203377-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_025077
Synonyms FLJ13949
Summary Inhibits cell growth rate and cell cycle. Induces CDKN1A expression as well as TGF-beta expression. Mediates the inhibitory growth effect of EGR1. Involved in the maturation of snRNAs and snRNA 3'-tail processing (PubMed:28092684).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...