TAP1 Human Gene Knockout Kit (CRISPR)

CAT#: KN204242BN

TAP1 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


Rabbit Polyclonal Anti-TAP1 Antibody
    • 50 ug

CNY 5,250.00


TAP1 (Myc-DDK-tagged)-Human transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (TAP1)
    • 10 ug

CNY 8,872.00

Specifications

Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA mBFP-Neo
Symbol TAP1
Locus ID 6890
Kit Components

KN204242G1, TAP1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTCCTCCCCTACTGGCGGCT

KN204242G2, TAP1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCTGAGCTTCTCGCCAGCGC

KN204242BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000593, NM_001292022
Synonyms ABC17; ABCB2; APT1; D6S114E; PSF-1; PSF1; RING4; TAP1 0102N; TAP1N
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in the pumping of degraded cytosolic peptides across the endoplasmic reticulum into the membrane-bound compartment where class I molecules assemble. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...