PKR (EIF2AK2) Human Gene Knockout Kit (CRISPR)
CAT#: KN210792LP
EIF2AK2 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
CNY 3,710.00
CNY 1,999.00
CNY 2,700.00
CNY 6,152.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
Donor DNA | Luciferase-Puro |
Symbol | PKR |
Locus ID | 5610 |
Kit Components |
KN210792G1, PKR gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TAATACATACCGTCAGAAGC KN210792G2, PKR gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TATCAAGAACTGCCTAATTC KN210792LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001135651, NM_001135652, NM_002759 |
Synonyms | EIF2AK1; PKR; PPP1R83; PRKR |
Summary | The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN210792 | EIF2AK2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN210792BN | EIF2AK2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN210792RB | EIF2AK2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN410792 | EIF2AK2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |
|
GA103800 | EIF2AK2 CRISPRa kit - CRISPR gene activation of human eukaryotic translation initiation factor 2 alpha kinase 2 |
CNY 12,255.00 |