Her2 (ERBB2) Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA	mBFP-Neo
Symbol	Her2
Locus ID	2064
Kit Components	KN212583G1, Her2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGTGGCTTCCAGGACCCCCG KN212583G2, Her2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GATGTGTTGTGTTTACCTTG KN212583BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_001005862, NM_001289936, NM_001289937, NM_001289938, NM_004448, NR_110535
Synonyms	CD340; HER-2; HER-2/neu; HER2; MLN 19; NEU; NGL; TKR1
Summary	This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.