TGF beta 2 (TGFB2) Human Gene Knockout Kit (CRISPR)
CAT#: KN212624BN
TGFB2 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | TGF beta 2 |
Locus ID | 7042 |
Kit Components |
KN212624G1, TGF beta 2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGGACCAGTTCATGCGCAAG KN212624G2, TGF beta 2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TAGATGGAAATCACCTCCGG KN212624BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001135599, NM_003238, NR_138148, NR_138149 |
Synonyms | G-TSF; LDS4; TGF-beta2 |
Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers. A chromosomal translocation that includes this gene is associated with Peters' anomaly, a congenital defect of the anterior chamber of the eye. Mutations in this gene may be associated with Loeys-Dietz syndrome. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN212624 | TGFB2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN212624LP | TGFB2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN212624RB | TGFB2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN412624 | TGFB2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |
|
GA104849 | TGFB2 CRISPRa kit - CRISPR gene activation of human transforming growth factor beta 2 |
CNY 12,255.00 |
其它TGF beta 2产品