CrkRS (CDK12) Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Symbol	CrkRS
Locus ID	51755
Kit Components	KN213898G1, CrkRS gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGTCACCAACCCCATGTCTT KN213898G2, CrkRS gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGTGCCCAGGGATGCTGCTT KN213898-D, donor DNA containing left and right homologous arms and functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_015083, NM_016507
Synonyms	CRK7; CRKR; CRKRS
Summary	Cyclin-dependent kinase that phosphorylates the C-terminal domain (CTD) of the large subunit of RNA polymerase II (POLR2A), thereby acting as a key regulator of transcription elongation. Regulates the expression of genes involved in DNA repair and is required for the maintenance of genomic stability. Preferentially phosphorylates 'Ser-5' in CTD repeats that are already phosphorylated at 'Ser-7', but can also phosphorylate 'Ser-2'. Required for RNA splicing, possibly by phosphorylating SRSF1/SF2. Involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogen inhibitors.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.