MET Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA	mBFP-Neo
Symbol	MET
Locus ID	4233
Kit Components	KN217003G1, MET gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCCCCCGCTGTGCTTGCACC KN217003G2, MET gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CCTCGTGCTCCTGTTTACCT KN217003BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_000245, NM_001127500, NM_001324401, NM_001324402
Synonyms	AUTS9; c-Met; DFNB97; HGFR; RCCP2
Summary	This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.