IL28 Receptor alpha (IFNLR1) Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA	mBFP-Neo
Symbol	IL28 Receptor alpha
Locus ID	163702
Kit Components	KN221789G1, IL28 Receptor alpha gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCGCTCCAGGTAAGGGCGCG KN221789G2, IL28 Receptor alpha gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TACCTGGAGCGGCCTGCAGC KN221789BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_170743, NM_173064, NM_173065
Synonyms	CRF2/12; IFNLR; IL-28R1; IL28RA; LICR2
Summary	The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.