Plectin (PLEC) Human Gene Knockout Kit (CRISPR)

CAT#: KN411981

PLEC - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated.




 KN2.0 knockout kit validation

  See Other Versions

CNY 8,680.00

CNY 12,260.00


货期*
2周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


Rabbit Polyclonal Anti-PLEC Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


PLEC (Myc-DDK-tagged)-Human plectin (PLEC), transcript variant 10
    • 10 ug

CNY 64,890.00

Specifications

Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol Plectin
Locus ID 5339
Kit Components

KN411981G1, Plectin gRNA vector 1 in pCas-Guide CRISPR vector

KN411981G2, Plectin gRNA vector 2 in pCas-Guide CRISPR vector

KN411981D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000445, NM_201378, NM_201379, NM_201380, NM_201381, NM_201382, NM_201383, NM_201384
Synonyms EBS1; EBSO; HD1; LGMD2Q; PCN; PLEC1; PLEC1b; PLTN
Summary Plectin is a prominent member of an important family of structurally and in part functionally related proteins, termed plakins or cytolinkers, that are capable of interlinking different elements of the cytoskeleton. Plakins, with their multi-domain structure and enormous size, not only play crucial roles in maintaining cell and tissue integrity and orchestrating dynamic changes in cytoarchitecture and cell shape, but also serve as scaffolding platforms for the assembly, positioning, and regulation of signaling complexes (reviewed in PMID: 9701547, 11854008, and 17499243). Plectin is expressed as several protein isoforms in a wide range of cell types and tissues from a single gene located on chromosome 8 in humans (PMID: 8633055, 8698233). Until 2010, this locus was named plectin 1 (symbol PLEC1 in human; Plec1 in mouse and rat) and the gene product had been referred to as "hemidesmosomal protein 1" or "plectin 1, intermediate filament binding 500kDa". These names were superseded by plectin. The plectin gene locus in mouse on chromosome 15 has been analyzed in detail (PMID: 10556294, 14559777), revealing a genomic exon-intron organization with well over 40 exons spanning over 62 kb and an unusual 5' transcript complexity of plectin isoforms. Eleven exons (1-1j) have been identified that alternatively splice directly into a common exon 2 which is the first exon to encode plectin's highly conserved actin binding domain (ABD). Three additional exons (-1, 0a, and 0) splice into an alternative first coding exon (1c), and two additional exons (2alpha and 3alpha) are optionally spliced within the exons encoding the acting binding domain (exons 2-8). Analysis of the human locus has identified eight of the eleven alternative 5' exons found in mouse and rat (PMID: 14672974); exons 1i, 1j and 1h have not been confirmed in human. Furthermore, isoforms lacking the central rod domain encoded by exon 31 have been detected in mouse (PMID:10556294), rat (PMID: 9177781), and human (PMID: 11441066, 10780662, 20052759). The short alternative amino-terminal sequences encoded by the different first exons direct the targeting of the various isoforms to distinct subcellular locations (PMID: 14559777). As the expression of specific plectin isoforms was found to be dependent on cell type (tissue) and stage of development (PMID: 10556294, 12542521, 17389230) it appears that each cell type (tissue) contains a unique set (proportion and composition) of plectin isoforms, as if custom-made for specific requirements of the particular cells. Concordantly, individual isoforms were found to carry out distinct and specific functions (PMID: 14559777, 12542521, 18541706). In 1996, a number of groups reported that patients suffering from epidermolysis bullosa simplex with muscular dystrophy (EBS-MD) lacked plectin expression in skin and muscle tissues due to defects in the plectin gene (PMID: 8698233, 8941634, 8636409, 8894687, 8696340). Two other subtypes of plectin-related EBS have been described: EBS-pyloric atresia (PA) and EBS-Ogna. For reviews of plectin-related diseases see PMID: 15810881, 19945614. Mutations in the plectin gene related to human diseases should be named based on the position in NM_000445 (variant 1, isoform 1c), unless the mutation is located within one of the other alternative first exons, in which case the position in the respective Reference Sequence should be used. [provided by RefSeq, Aug 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...