TrueORF® cDNA Clones: Ready-to-Use Tagged cDNA Clones
TrueORF cDNA clones are tagged ORF clones in mammalian expression vectors
- Genome wide coverage for human, mouse and rat
- Two types of tags: Myc-DDK tagged or GFP tagged
- New: Lenti options are now available.
- 20,000 Human clones are validated for protein expression
- 70 destination vectors for additional applications
- Clone collections available
The same ORF inserts are available in 4 different expression vectors
pCMV6-Entry | pCMV6-AC-GFP | pLenti-C-Myc-DDK | pLenti-C-mGFP | |
---|---|---|---|---|
Vector SKU | PS100001 | PS100010 | PS100064 | PS100071 |
Vector Map | ![]() |
![]() |
![]() |
![]() |
Fusion Tag | C-terminal Myc-DDK | C-terminal tGFP | C-terminal Myc-DDK | C-terminal mGFP |
Ideal For | Detection and pufirication of over-expressed protein | Tracking the over-expressed protein in tranfected cells | In hard-to-transfect cells: Detection and purification of over-expressed protein | Tracking the over-expressed protein in tranfected cells |
Technical features of TrueORF:
- The CMV promoter and a Kozak consensus sequence drive protein expression in mammalian cells.
- The C-terminus of the ORF is tagged with Myc/DDK* or tGFP.
- Ten (10) ug of purified plasmid is provided for immediate transfection and expression experiments.
- The upstream T7 promoter allows protein expression in cell-free system.
- Engineered as the entry vector for the OriGene PrecisionShuttle system.
Each TrueORF Clone is provided with a pair of sequencing primers:
Primer name | Primer sequence (for sequencing) |
---|---|
VP1.5 (forward) | 5' GGACTTTCCAAAATGTCG 3' |
XL39 (reverse) | 5' ATTAGGACAAGGCTGGTGGG 3' |
* Peptide sequence of the DDK-tag (Flag®): N-DYKDDDDK-C Flag® is a registered trademark of Sigma-Aldrich