AARSD1 (PTGES3L-AARSD1) (NM_025267) Human 3' UTR Clone

CAT#: SC200314

3' UTR clone of alanyl-tRNA synthetase domain containing 1 (AARSD1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AARSD1 (PTGES3L-AARSD1) (NM_025267) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_025267
Insert Size 97 bp
Sequence Data
>SC200314 3’UTR clone of NM_025267
The sequence shown below is from the reference sequence of NM_025267. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACATCAGCACGCAGAGTGCTAAGGAGTGAGGGCTTAGGGCACTCACCTCCTGTTTCCACAGGAATCTT
TTGGTCAATAAAATAGATTGACTCAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_025267.4
Summary This locus represents naturally occurring readthrough transcription between the neighboring PTGES3L (prostaglandin E synthase 3 (cytosolic)-like) and AARSD1(alanyl-tRNA synthetase domain containing 1) genes on chromosome 17. The readthrough transcript encodes a fusion protein that shares sequence identity with each individual gene product. [provided by RefSeq, May 2012]
Locus ID 100885850
MW 3.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...