Vitronectin (VTN) (NM_000638) Human 3' UTR Clone

CAT#: SC200508

3' UTR clone of vitronectin (VTN) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Vitronectin (VTN) (NM_000638) Human 3' UTR Clone
Vector pMirTarget
Synonyms V75; VN; VNT
ACCN NM_000638
Insert Size 115 bp
Sequence Data
>SC200508 3’UTR clone of NM_000638
The sequence shown below is from the reference sequence of NM_000638. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGGCTGCCCAGCTCCTGGCCATCTGTAGGAGTCAGAGCCCACATGGCCGGGCCCTCTGTAGCTCCCT
CCTCCCATCTCCTTCCCCCAGCCCAATAAAGGTCCCTTAGCCCCGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000638.4
Synonyms V75; VN; VNT
Summary The protein encoded by this gene functions in part as an adhesive glycoprotein. Differential expression of this protein can promote either cell adhesion or migration as it links cells to the extracellular matrix through a variety of ligands. These ligands include integrins, plasminogen activator inhibitor-1, and urokinase plasminogen activator receptor. This secreted protein can be present in the plasma as a monomer or dimer and forms a multimer in the extracellular matrix of several tissues. This protein also inhibits the membrane-damaging effect of the terminal cytolytic complement pathway and binds to several serpin serine protease inhibitors. This protein can also promote extracellular matrix degradation and thus plays a role in tumorigenesis. It is involved in a variety of other biological processes such as the regulation of the coagulation pathway, wound healing, and tissue remodeling. The heparin-binding domain of this protein give it anti-microbial properties. It is also a lipid binding protein that forms a principal component of high density lipoprotein. [provided by RefSeq, Aug 2020]
Locus ID 7448
MW 3.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...