RPL10L (NM_080746) Human 3' UTR Clone

CAT#: SC200672

3' UTR clone of ribosomal protein L10-like (RPL10L) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RPL10L (NM_080746) Human 3' UTR Clone
Vector pMirTarget
Synonyms RPL10_5_1358
ACCN NM_080746
Insert Size 112 bp
Sequence Data
>SC200672 3’UTR clone of NM_080746
The sequence shown below is from the reference sequence of NM_080746. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGGACAAGTGGCGGGTTCTGCACTCATGAAGGTTTTGGCAGTACTGTCTCCTTGGGCCATGCTGGTCT
GACTTATGCTTACTAATAAATTCTGTTTACTGGCAAAAAATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_080746.3
Synonyms RPL10_5_1358
Summary This gene encodes a protein sharing sequence similarity with ribosomal protein L10. It is not currently known whether the encoded protein is a functional ribosomal protein or whether it has evolved a function that is independent of the ribosome. This gene is intronless. [provided by RefSeq, Jul 2008]
Locus ID 140801
MW 4.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...