Caspase 5 (CASP5) (NM_001136112) Human 3' UTR Clone

CAT#: SC200803

3' UTR clone of caspase 5 apoptosis-related cysteine peptidase (CASP5) transcript variant f for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Caspase 5 (CASP5) (NM_001136112) Human 3' UTR Clone
Vector pMirTarget
Synonyms ICE(rel)III; ICEREL-III; ICH-3
ACCN NM_001136112
Insert Size 139 bp
Sequence Data
>SC200803 3’UTR clone of NM_001136112
The sequence shown below is from the reference sequence of NM_001136112. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGATTTCTACCTCTTTCCTGGCAATTGAAAATGAAACCACAGGCAGCCCAGCCCTCCTCTGTCAACA
TCAAAGAGCACATTTACCAGTATAGCTTGCATAGTCAATATTTGGTATTTCAATAAAAGTAAAGACTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001136112.3
Synonyms ICE(rel)III; ICEREL-III; ICH-3
Summary This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. Overexpression of the active form of this enzyme induces apoptosis in fibroblasts. Max, a central component of the Myc/Max/Mad transcription regulation network important for cell growth, differentiation, and apoptosis, is cleaved by this protein; this process requires Fas-mediated dephosphorylation of Max. The expression of this gene is regulated by interferon-gamma and lipopolysaccharide. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]
Locus ID 838
MW 5.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...