GUCY1A3 (NM_001130686) Human 3' UTR Clone

CAT#: SC200857

3' UTR clone of guanylate cyclase 1 soluble alpha 3 (GUCY1A3) transcript variant 6 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GUCY1A3 (NM_001130686) Human 3' UTR Clone
Vector pMirTarget
Synonyms GC-SA3; GUC1A3; GUCA3; GUCSA3; GUCY1A1
ACCN NM_001130686
Insert Size 145 bp
Sequence Data
>SC200857 3’UTR clone of NM_001130686
The sequence shown below is from the reference sequence of NM_001130686. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAAAATCTTCAAGGGTAAGGAAAACATAATACTATCTTGAATATGAAAGCTATTTCATATTTAAGAGC
AAGAAACAAAAGGGTAAAAATATATGCATCACTTCAAATGTTTGATAAAACATATGTAAAACAATGGTA
AAAGAAT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001130686.1
Synonyms GC-SA3; GUC1A3; GUCA3; GUCSA3; GUCY1A1
Summary Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Locus ID 2982
MW 5.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...