FASTK (NM_006712) Human 3' UTR Clone

CAT#: SC200899

3' UTR clone of Fas-activated serine/threonine kinase (FASTK) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FASTK (NM_006712) Human 3' UTR Clone
Vector pMirTarget
Synonyms FAST
ACCN NM_006712
Insert Size 131 bp
Sequence Data
>SC200899 3’UTR clone of NM_006712
The sequence shown below is from the reference sequence of NM_006712. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCCTGCGCTGGGGGCCTGAAGGGGGCTGAGGGGTTGATGTGGGGTTCAGGATGGCCCCCCCATGGGGG
GTGGATGATTTGCACTTTGGTTCCCTGTGTTTTGATTTCTCATTAAAGTTCCTTTCCTTCCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006712.5
Synonyms FAST
Summary The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase was shown to be activated rapidly during Fas-mediated apoptosis in Jurkat cells. In response to Fas receptor ligation, it phosphorylates TIA1, an apoptosis-promoting nuclear RNA-binding protein. The encoded protein is a strong inducer of lymphocyte apoptosis. Two transcript variants encoding different isoforms have been found for this gene. Other variants exist, but their full-length natures have not yet been determined. [provided by RefSeq, Jul 2008]
Locus ID 10922
MW 4.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...