Alpha B Crystallin (CRYAB) (NM_001885) Human 3' UTR Clone

CAT#: SC201206

3' UTR clone of crystallin alpha B (CRYAB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Alpha B Crystallin (CRYAB) (NM_001885) Human 3' UTR Clone
Vector pMirTarget
Synonyms CMD1II; CRYA2; CTPP2; CTRCT16; HEL-S-101; HSPB5; MFM2
ACCN NM_001885
Insert Size 230 bp
Sequence Data
>SC201206 3’UTR clone of NM_001885
The sequence shown below is from the reference sequence of NM_001885. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTGCTGTCACCGCAGCCCCCAAGAAATAGATGCCCTTTCTTGAATTGCATTTTTTAAAACAAGAAAGT
TTCCCCACCAGTGAATGAAAGTCTTGTGACTAGTGCTGAAGCTTATTAATGCTAAGGGCAGGCCCAAAT
TATCAAGCTAATAAAATATCATTCAGCAACAGATAACTGTCTTGTGTTTGAATATTCCACACACTTTTA
AATAAATATACAGATACCACAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001885.3
Synonyms CMD1II; CRYA2; CTPP2; CTRCT16; HEL-S-101; HSPB5; MFM2
Summary Mammalian lens crystallins are divided into alpha, beta, and gamma families. Alpha crystallins are composed of two gene products: alpha-A and alpha-B, for acidic and basic, respectively. Alpha crystallins can be induced by heat shock and are members of the small heat shock protein (HSP20) family. They act as molecular chaperones although they do not renature proteins and release them in the fashion of a true chaperone; instead they hold them in large soluble aggregates. These heterogeneous aggregates consist of 30-40 subunits; the alpha-A and alpha-B subunits have a 3:1 ratio, respectively. Two additional functions of alpha crystallins are an autokinase activity and participation in the intracellular architecture. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Alpha-A and alpha-B gene products are differentially expressed; alpha-A is preferentially restricted to the lens and alpha-B is expressed widely in many tissues and organs. Elevated expression of alpha-B crystallin occurs in many neurological diseases; a missense mutation cosegregated in a family with a desmin-related myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2019]
Locus ID 1410
MW 8.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...