DHX16 (NM_003587) Human 3' UTR Clone

CAT#: SC201232

3' UTR clone of DEAH (Asp-Glu-Ala-His) box polypeptide 16 (DHX16) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DHX16 (NM_003587) Human 3' UTR Clone
Vector pMirTarget
Synonyms DBP2; DDX16; NMOAS; PRO2014; Prp2; PRP8; PRPF2
ACCN NM_003587
Insert Size 145 bp
Sequence Data
>SC201232 3’UTR clone of NM_003587
The sequence shown below is from the reference sequence of NM_003587. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATAGGCAAAACACGAGAAGAGCTAGGGTAAGAGAAGGACGTAAACAGAACCTGACACCAGCTCCTTTTC
CTTCTATACATTATTTAATACCTATTAAATAAAATTATTTTTGGAATAAAGCTTGTGGGAACATTTGGG
ATCTAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003587.5
Synonyms DBP2; DDX16; NMOAS; PRO2014; Prp2; PRP8; PRPF2
Summary DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a functional homolog of fission yeast Prp8 protein involved in cell cycle progression. This gene is mapped to the MHC region on chromosome 6p21.3, a region where many malignant, genetic and autoimmune disease genes are linked. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2018]
Locus ID 8449
MW 5.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...