Casein Kinase 2 beta (CSNK2B) (NM_001320) Human 3' UTR Clone

CAT#: SC201247

3' UTR clone of casein kinase 2 beta polypeptide (CSNK2B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Casein Kinase 2 beta (CSNK2B) (NM_001320) Human 3' UTR Clone
Vector pMirTarget
Synonyms CK2B; CK2N; Ckb1; Ckb2; CSK2B; G5A; POBINDS
ACCN NM_001320
Insert Size 171 bp
Sequence Data
>SC201247 3’UTR clone of NM_001320
The sequence shown below is from the reference sequence of NM_001320. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCAAGAGCCCAGTCAAGACGATTCGCTGATTCCCTCCCCCACCTGTCCTGCAGTCTTTGACTTTTCCT
TTCTTTTTTGCCACCCTTTCAGGAACCCTGTATGGTTTTTAGTTTAAATTAAAGGAGTCGTTATCGTGG
TGGGAATATGAAATAAAGTAGAAGAAAAGGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001320.7
Synonyms CK2B; CK2N; Ckb1; Ckb2; CSK2B; G5A; POBINDS
Summary This gene encodes the beta subunit of casein kinase II, a ubiquitous protein kinase which regulates metabolic pathways, signal transduction, transcription, translation, and replication. The enzyme is composed of three subunits, alpha, alpha prime and beta, which form a tetrameric holoenzyme. The alpha and alpha prime subunits are catalytic, while the beta subunit serves regulatory functions. The enzyme localizes to the endoplasmic reticulum and the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Locus ID 1460
MW 6.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...