UCKL1 (NM_017859) Human 3' UTR Clone

CAT#: SC201299

3' UTR clone of uridine-cytidine kinase 1-like 1 (UCKL1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name UCKL1 (NM_017859) Human 3' UTR Clone
Vector pMirTarget
Synonyms UCK1L; URKL1
ACCN NM_017859
Insert Size 177 bp
Sequence Data
>SC201299 3’UTR clone of NM_017859
The sequence shown below is from the reference sequence of NM_017859. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACGAGGAGGAAGTGGCCTACACGGGTTAGCTGCCCAGTGAGCCATCCCGTCCCCACCACCCTCCTCCT
GCCTCCTGACCCAGGACTGCTGAATACAAAGATGTTAATTTTTAAAATGTTACTAGTATAATTTATTCT
ATGCATTTTATAAAATAAATAAAGCTTTAGAAAAATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017859.4
Synonyms UCK1L; URKL1
Summary The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Locus ID 54963
MW 6.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...