KEL (NM_000420) Human 3' UTR Clone

CAT#: SC201434

3' UTR clone of Kell blood group metallo-endopeptidase (KEL) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KEL (NM_000420) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD238; ECE3; Kell
ACCN NM_000420
Insert Size 168 bp
Sequence Data
>SC201434 3’UTR clone of NM_000420
The sequence shown below is from the reference sequence of NM_000420. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACCCCTCCAGCCGCTGCCAGCTCTGGTAACTTGGTTACCAAAGATGCCACAGCACAGAAATATCGACC
AACACCTCCCTGGTCACATCCATGGAATCAGAGCAAGATTTCCTTTCTGCTTCTGTTCCAAAAATAAAA
GCTGGCACTTGGCTTCCGCTTGTCTCTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000420.3
Synonyms CD238; ECE3; Kell
Summary This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
Locus ID 3792
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...