CDKN3 (NM_005192) Human 3' UTR Clone

CAT#: SC201445

3' UTR clone of cyclin-dependent kinase inhibitor 3 (CDKN3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CDKN3 (NM_005192) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDI1; CIP2; KAP; KAP1
ACCN NM_005192
Insert Size 170 bp
Sequence Data
>SC201445 3’UTR clone of NM_005192
The sequence shown below is from the reference sequence of NM_005192. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATTCACAATCAAGATCTGTATCAAGATAAAGGAATTCAAATAGCATATATATGACCATGTCTGAAATG
TCAGTTCTCTAGCATAATTTGTATTGAAATGAAACCACCAGTGTTATCAACTTGAATGTAAATGTACAT
GTGCAGATATTCCTAAAGTTTTATTGACAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005192.4
Synonyms CDI1; CIP2; KAP; KAP1
Summary The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Locus ID 1033
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...