TRIP6 (NM_003302) Human 3' UTR Clone

CAT#: SC201586

3' UTR clone of thyroid hormone receptor interactor 6 (TRIP6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TRIP6 (NM_003302) Human 3' UTR Clone
Vector pMirTarget
Synonyms OIP-1; OIP1; TRIP-6; TRIP6i2; ZRP-1
ACCN NM_003302
Insert Size 181 bp
Sequence Data
>SC201586 3’UTR clone of NM_003302
The sequence shown below is from the reference sequence of NM_003302. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCTCAGCCACCGTCACCACTGACTGCTGAGTCTTCCTAGAAGTACCTGCTGGGTTCTCAGTTCCAGTT
CCCATCCTTTGATTGATCACTCTCCCTGACATCCACCTGTATGACTTTGTCACCAAATGCTGTCTTCTC
TTTCTCCAATCAAGAAATAATAATCCCTCGAGTTTACAAAACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003302.3
Synonyms OIP-1; OIP1; TRIP-6; TRIP6i2; ZRP-1
Summary This gene is a member of the zyxin family and encodes a protein with three LIM zinc-binding domains. This protein localizes to focal adhesion sites and along actin stress fibers. Recruitment of this protein to the plasma membrane occurs in a lysophosphatidic acid (LPA)-dependent manner and it regulates LPA-induced cell migration. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Locus ID 7205
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...