SAMM50 (NM_015380) Human 3' UTR Clone

CAT#: SC201662

3' UTR clone of sorting and assembly machinery component 50 homolog (S. cerevisiae) (SAMM50) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SAMM50 (NM_015380) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGI-51; OMP85; SAM50; TOB55; TRG-3; YNL026W
ACCN NM_015380
Insert Size 176 bp
Sequence Data
>SC201662 3’UTR clone of NM_015380
The sequence shown below is from the reference sequence of NM_015380. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGTTTGGAGCTGGGATAAGGTTCCTGTAGCCGACACCCCTACAGGAGAAGCTCTGGGACTGGGGCAGC
AGCAAGGCGCCCATGCCACACACCGTCTCTCGAGGAAACGCGGTTCAGCGATTCTTTGACTGCGGACCC
TGTGGGAAACCCCGTCAATAAATGTTAAAGACACACTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015380.5
Synonyms CGI-51; OMP85; SAM50; TOB55; TRG-3; YNL026W
Summary This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]
Locus ID 25813
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...