UROD (NM_000374) Human 3' UTR Clone

CAT#: SC201746

3' UTR clone of uroporphyrinogen decarboxylase (UROD) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name UROD (NM_000374) Human 3' UTR Clone
Vector pMirTarget
Synonyms PCT; UPD
ACCN NM_000374
Insert Size 107 bp
Sequence Data
>SC201746 3’UTR clone of NM_000374
The sequence shown below is from the reference sequence of NM_000374. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAACACTCACGTCTGCTTCGACAGAACTGAGTGTATACCTTTACCCTCAAGTACCACTAACACAGATGA
TTGATCGTTTCCAGGACAATAAAAGTTTCGGAGTTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000374.5
Synonyms PCT; UPD
Summary This gene encodes an enzyme in the heme biosynthetic pathway. This enzyme is responsible for catalyzing the conversion of uroporphyrinogen to coproporphyrinogen through the removal of four carboxymethyl side chains. Mutations and deficiency in this enzyme are known to cause familial porphyria cutanea tarda and hepatoerythropoetic porphyria.[provided by RefSeq, Aug 2010]
Locus ID 7389
MW 4.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...