IFI27 (NM_005532) Human 3' UTR Clone

CAT#: SC201775

3' UTR clone of interferon alpha-inducible protein 27 (IFI27) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IFI27 (NM_005532) Human 3' UTR Clone
Vector pMirTarget
Synonyms FAM14D; ISG12; ISG12A; P27
ACCN NM_005532
Insert Size 193 bp
Sequence Data
>SC201775 3’UTR clone of NM_005532
The sequence shown below is from the reference sequence of NM_005532. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTGCGGCTGTCATTGCGAGGTTCTACTAGCTCCCTGCCCCTCGCCCTGCAGAGAAGAGAACCATGCCA
GGGGAGAAGGCACCCAGCCATCCTGACCCAGCGAGGAGCCAACTATCCCAAATATACCTGGGGTGAAAT
ATACCAAATTCTGCATCTCCAGAGGAAAATAAGAAATAAAGATGAATTGTTGCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005532.5
Synonyms FAM14D; ISG12; ISG12A; P27
Summary Probable adapter protein involved in different biological processes (PubMed:22427340, PubMed:27194766). Part of the signaling pathways that lead to apoptosis (PubMed:18330707, PubMed:27673746, PubMed:24970806). Involved in type-I interferon-induced apoptosis characterized by a rapid and robust release of cytochrome C from the mitochondria and activation of BAX and caspases 2, 3, 6, 8 and 9 (PubMed:18330707, PubMed:27673746). Also functions in TNFSF10-induced apoptosis (PubMed:24970806). May also have a function in the nucleus, where it may be involved in the interferon-induced negative regulation of the transcriptional activity of NR4A1, NR4A2 and NR4A3 through the enhancement of XPO1-mediated nuclear export of these nuclear receptors (PubMed:22427340). May thereby play a role in the vascular response to injury (By similarity). In the innate immune response, has an antiviral activity towards hepatitis C virus/HCV (PubMed:27194766, PubMed:27777077). May prevent the replication of the virus by recruiting both the hepatitis C virus non-structural protein 5A/NS5A and the ubiquitination machinery via SKP2, promoting the ubiquitin-mediated proteasomal degradation of NS5A (PubMed:27194766, PubMed:27777077).[UniProtKB/Swiss-Prot Function]
Locus ID 3429
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...