stabilin1 (STAB1) (NM_015136) Human 3' UTR Clone

CAT#: SC201886

3' UTR clone of stabilin 1 (STAB1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name stabilin1 (STAB1) (NM_015136) Human 3' UTR Clone
Vector pMirTarget
Synonyms CLEVER-1; FEEL-1; FELE-1; FEX1; SCARH2; STAB-1
ACCN NM_015136
Insert Size 169 bp
Sequence Data
>SC201886 3’UTR clone of NM_015136
The sequence shown below is from the reference sequence of NM_015136. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACACCCAGAGGATCCTCACAGTCAAGTGACGAGGCTGGGGCTGAAAGCAGAAGCATGCACAGGGAGGA
GACCACTTTTATTGCTTGTCTGGGTGGATGGGGCAGGAGGGGCTGAGGGCCTGTCCCAGACAATAAAGG
TGCCCTCAGCGGATGTGGGCCATGTCACCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015136.3
Synonyms CLEVER-1; FEEL-1; FELE-1; FEX1; SCARH2; STAB-1
Summary This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
Locus ID 23166
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...