67kDa Laminin Receptor (RPSA) (NM_002295) Human 3' UTR Clone

CAT#: SC201936

3' UTR clone of ribosomal protein SA (RPSA) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name 67kDa Laminin Receptor (RPSA) (NM_002295) Human 3' UTR Clone
Vector pMirTarget
Synonyms 37LRP; 67LR; ICAS; LAMBR; lamR; LAMR1; LBP; LBP/p40; LRP; LRP/LR; NEM/1CHD4; p40; SA
ACCN NM_002295
Insert Size 204 bp
Sequence Data
>SC201936 3’UTR clone of NM_002295
The sequence shown below is from the reference sequence of NM_002295. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGGTAGGAGCAACCACTGACTGGTCTTAAGCTGTTCTTGCATAGGCTCTTAAGCAGCATGGAAAAATG
GTTGATGGAAAATAAACATCAGTTTCTAAAAGTTGTCTTCATTTAGTTTGCTTTTTACTCCAGATCAGA
ATACCTGGGATTGCATATCAAAGCATAATAATAAATACATGTCTCGACATGAGTTGTACTTCTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002295.6
Synonyms 37LRP; 67LR; ICAS; LAMBR; lamR; LAMR1; LBP; LBP/p40; LRP; LRP/LR; NEM/1CHD4; p40; SA
Summary Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 3921
MW 7.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...