AKR1C3 (NM_003739) Human 3' UTR Clone

CAT#: SC201954

3' UTR clone of aldo-keto reductase family 1 member C3 (3-alpha hydroxysteroid dehydrogenase type II) (AKR1C3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AKR1C3 (NM_003739) Human 3' UTR Clone
Vector pMirTarget
Synonyms DD3; DDX; HA1753; HAKRB; HAKRe; hluPGFS; HSD17B5; PGFS
ACCN NM_003739
Insert Size 201 bp
Sequence Data
>SC201954 3' UTR clone of NM_003739
The sequence shown below is from the reference sequence of NM_003739. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTTTTGCTAGCCACCCTAATTATCCATATTCAGATGAATATTAACATGGAGGGCTTTGCCTGATGTCTAC
CAGAAGCCCTGTGTGTGGATGGTGACGCAGAGGACGTCTCTATGCCGGTGACTGGACATATCACCTCTAC
TTAAATCCGTCCTGTTTAGCGACTTCAGTCAACTACAGCTGAGTCCATAGGCCAGAAAGAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003739.4
Synonyms DD3; DDX; HA1753; HAKRB; HAKRe; hluPGFS; HSD17B5; PGFS
Summary This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reduction of prostaglandin (PG) D2, PGH2 and phenanthrenequinone (PQ), and the oxidation of 9alpha,11beta-PGF2 to PGD2. It may play an important role in the pathogenesis of allergic diseases such as asthma, and may also have a role in controlling cell growth and/or differentiation. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Locus ID 8644
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...