Probable hydrolase PNKD (PNKD) (NM_001077399) Human 3' UTR Clone

CAT#: SC202247

3' UTR clone of paroxysmal nonkinesigenic dyskinesia (PNKD) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Probable hydrolase PNKD (PNKD) (NM_001077399) Human 3' UTR Clone
Vector pMirTarget
Synonyms BRP17; DYT8; FKSG19; FPD1; KIPP1184; MR-1; MR-1S; MR1; PDC; PKND1; PNKD1; R1; TAHCCP2
ACCN NM_001077399
Insert Size 184 bp
Sequence Data
>SC202247 3' UTR clone of NM_001077399
The sequence shown below is from the reference sequence of NM_001077399. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCCTGATGTTGGGTCTGGGGTGCAGACCTGAGGAGCGCTGCGACCCTCCTAGGCTATTGACTGTTAAGTC
CTCAGGTTTGGCCCAGATTCCAGTTCGTGCCTCTGAGGTCCACCAGAGGGCGCATGAAGCCCAGGCTGTT
GCCAAACCCTACCCTGCCCCACACCAAGGAGCCAGCCAAAGGCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001077399.2
Synonyms BRP17; DYT8; FKSG19; FPD1; KIPP1184; MR-1; MR-1S; MR1; PDC; PKND1; PNKD1; R1; TAHCCP2
Summary This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Locus ID 25953
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...