Slingshot homolog 1 (SSH1) (NM_001161331) Human 3' UTR Clone

CAT#: SC202256

3' UTR clone of slingshot homolog 1 (Drosophila) (SSH1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Slingshot homolog 1 (SSH1) (NM_001161331) Human 3' UTR Clone
Vector pMirTarget
Synonyms SSH1L
ACCN NM_001161331
Insert Size 231 bp
Sequence Data
>SC202256 3’UTR clone of NM_001161331
The sequence shown below is from the reference sequence of NM_001161331. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGGACCTGAGGGTTCTTTCACAGGGTGATTCTGCTGGTGGGTACGTAGTGCATACCTTATATAGCAA
ATTGAGAATCTGTTGGGAATAACACATATCTCTGCACACCATCTTCACCCCATGTACCTTATTCATACC
CTGGGCAGGGCTTCCAACTCAATTTCTTTTTGTGTATGTAAAATTAAAACATATAATTTATCAGCCAAC
TTCAAAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001161331.1
Synonyms SSH1L
Summary The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Locus ID 54434
MW 8.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...