LYAR (NM_001145725) Human 3' UTR Clone

CAT#: SC202297

3' UTR clone of Ly1 antibody reactive homolog (mouse) (LYAR) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name LYAR (NM_001145725) Human 3' UTR Clone
Vector pMirTarget
Synonyms ZC2HC2; ZLYAR
ACCN NM_001145725
Insert Size 219 bp
Sequence Data
>SC202297 3' UTR clone of NM_001145725
The sequence shown below is from the reference sequence of NM_001145725. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTTATTAAAGGACAAAGTCAAGCTTGTGAAATGAACATTTGTGTATTTAAAAATTGAATCCATTCTGCTG
ACTTCTTCCTTTCACTGCTGTTTATAAAATGTGTAATGAATTCTAACAACTCAAATTTTGCTTTTTGAAG
CTGTATTTTTAAGTTAAGAAAATATATTTTTGGTATAACTTTTATGAGAAAAATAAAATATATTCTGGTC
CAAACTTCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001145725.1
Synonyms ZC2HC2; ZLYAR
Summary Plays a role in the maintenance of the appropriate processing of 47S/45S pre-rRNA to 32S/30S pre-rRNAs and their subsequent processing to produce 18S and 28S rRNAs (PubMed:24495227). Also acts at the level of transcription regulation. Along with PRMT5, binds the gamma-globin (HBG1/HBG2) promoter and represses its expression (PubMed:25092918). In neuroblastoma cells, may also repress the expression of oxidative stress genes, including CHAC1, HMOX1, SLC7A11, ULBP1 and SNORD41 that encodes a small nucleolar RNA (PubMed:28686580). Preferentially binds to a DNA motif containing 5'-GGTTAT-3' (PubMed:25092918). Stimulates phagocytosis of photoreceptor outer segments by retinal pigment epithelial cells (By similarity). Prevents nucleolin/NCL self-cleavage, maintaining a normal steady-state level of NCL protein in undifferentiated embryonic stem cells (ESCs), which in turn is essential for ESC self-renewal (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 55646
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...