APOBEC3F (NM_001006666) Human 3' UTR Clone

CAT#: SC202609

3' UTR clone of apolipoprotein B editing enzyme catalytic polypeptide-like 3F (APOBEC3F) transcript variant 2 mRNA for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name APOBEC3F (NM_001006666) Human 3' UTR Clone
Vector pMirTarget
Synonyms A3F; ARP8; BK150C2.4.MRNA; KA6
ACCN NM_001006666
Insert Size 236 bp
Sequence Data
>SC202609 3’UTR clone of NM_001006666
The sequence shown below is from the reference sequence of NM_001006666. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCGCAGGCAGGGAACAAGGCAGACCCTAGAGGGCCAGGCCACAGCAGGGGCTGAGGATGCCTGGTGAA
TGGATGCCTGGGAGAATGGATGCCAGAATTCACGCATGAGGCTCTGAACAGGGCTGGGAAAACTTCCAA
ACGAAGGGAAGCTCATGTCTTGGTGCACTTTGTGATGATGCTTCAACAGCAGGACTGAGATGGGGACAT
TTACAATAAACAGAAATGTATGGGCTCGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001006666.2
Synonyms A3F; ARP8; BK150C2.4.MRNA; KA6
Summary This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 200316
MW 8.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...