TNNT3 (NM_001042780) Human 3' UTR Clone

CAT#: SC202706

3' UTR clone of troponin T type 3 (skeletal fast) (TNNT3) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TNNT3 (NM_001042780) Human 3' UTR Clone
Vector pMirTarget
Synonyms beta-TnTF; DA2B2; TNTF
ACCN NM_001042780
Insert Size 240 bp
Sequence Data
>SC202706 3’UTR clone of NM_001042780
The sequence shown below is from the reference sequence of NM_001042780. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGGCAAAGTCGGCGGGCGCTGGAAGTAGAGAGGCCAGAAAGGCCCCTCGAGGCAGAGACCCTCCGCC
CTCTTGCACACCAGGGCCGCTCGTGGGACTCCACATCCTCCAGCCCCCACAATCCTGTCAGGGGCTCCC
TGACAGTCCTGGGGGTGGAGAGGCCATCCCGGGGCGTCCCCCGCGTCTGTGTCCTTGCTGCCTTCATCC
CCTGGGGCCTGTGAATAAAGCTGCAGAACCCCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001042780.3
Synonyms beta-TnTF; DA2B2; TNTF
Summary The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009]
Locus ID 7140
MW 8.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...