PPIG (NM_004792) Human 3' UTR Clone

CAT#: SC202774

3' UTR clone of peptidylprolyl isomerase G (cyclophilin G) (PPIG) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PPIG (NM_004792) Human 3' UTR Clone
Vector pMirTarget
Synonyms CARS-Cyp; CYP; SCAF10; SRCyp
ACCN NM_004792
Insert Size 233 bp
Sequence Data
>SC202774 3' UTR clone of NM_004792
The sequence shown below is from the reference sequence of NM_004792. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAATCAAGCCCTGGAACAGATGAAGACAAAAGCGGATGAGTGAGTTATATAAACTTACTTCCATTCTGTT
TCGGATTTTAAGTTTGAGAGACTTGCTAATGAATCTCCTTTATGTTGTTTTCCTTTTCATTGTTTTTGGA
TTGTTTTATGTTTGTCCTTTTTTTTCTTAATGTGGATTTCATTGAGTTGATTTTTTGATAATCTGCAATC
TGGATAATTTGTACTGCTAAAGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004792.2
Synonyms CARS-Cyp; CYP; SCAF10; SRCyp
Summary PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding (PubMed:20676357). May be implicated in the folding, transport, and assembly of proteins. May play an important role in the regulation of pre-mRNA splicing.[UniProtKB/Swiss-Prot Function]
Locus ID 9360
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...