GCS1 (MOGS) (NM_001146158) Human 3' UTR Clone

CAT#: SC202792

3' UTR clone of mannosyl-oligosaccharide glucosidase (MOGS) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GCS1 (MOGS) (NM_001146158) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDG2B; CWH41; DER7; GCS1
ACCN NM_001146158
Insert Size 248 bp
Sequence Data
>SC202792 3’UTR clone of NM_001146158
The sequence shown below is from the reference sequence of NM_001146158. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCTTACTGGCCATGGCTGAAGACTACTGAAGGGAGGGAGAGGAGGGGAGCCAAGACACTCATGCCACT
CTGGCTCTGAAGGGACAAAGGCTTCTGGCTTTTGCCCCCAGCCCCTTGGATACCAGTAATTCAAACCTT
CCTCATTTCATCTCAGGTGTCTCCTTGCTGTCATCCCACATAGCCCTGGGGTGAATGTGAATCCAGAGT
CTATTTTTCTAAATAAATTGGAAAAAACATTTTGAACTCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001146158.2
Synonyms CDG2B; CWH41; DER7; GCS1
Summary This gene encodes the first enzyme in the N-linked oligosaccharide processing pathway. The enzyme cleaves the distal alpha-1,2-linked glucose residue from the Glc(3)-Man(9)-GlcNAc(2) oligosaccharide precursor. This protein is located in the lumen of the endoplasmic reticulum. Defects in this gene are a cause of type IIb congenital disorder of glycosylation (CDGIIb). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Locus ID 7841
MW 9.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...