NR2C1 (NM_001032287) Human 3' UTR Clone

CAT#: SC202972

3' UTR clone of nuclear receptor subfamily 2 group C member 1 (NR2C1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NR2C1 (NM_001032287) Human 3' UTR Clone
Vector pMirTarget
Synonyms TR2
ACCN NM_001032287
Insert Size 240 bp
Sequence Data
>SC202972 3’UTR clone of NM_001032287
The sequence shown below is from the reference sequence of NM_001032287. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACAATAGTCTTCAACAAGCAGAGGGGTAATCACCTTAAAATGTCATCAAAAATAGATCTACTAGAAGG
CAGCATCACATTCCCATCTTACTTATGGACTCCTACCCCTGGTTCATGTCTTATATGCCTGTAATGGTT
ATAAAGCCTACCTTCAGGAAAGCTATGGTTGACTAATTACTAATGGATGGGTTTTAAACATGTCCCTCT
ACAATAAATTAAAATCTTTATTGTAAAACTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001032287.3
Synonyms TR2
Summary This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Locus ID 7181
MW 9.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...