HSP70-1A (HSPA1A) (NM_005345) Human 3' UTR Clone

CAT#: SC203537

3' UTR clone of heat shock 70kDa protein 1A (HSPA1A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HSP70-1A (HSPA1A) (NM_005345) Human 3' UTR Clone
Vector pMirTarget
Synonyms HEL-S-103; HSP70-1; HSP70-1A; HSP70-2; HSP70.1; HSP70.2; HSP70I; HSP72; HSPA1
ACCN NM_005345
Insert Size 290 bp
Sequence Data
>SC203537 3’UTR clone of NM_005345
The sequence shown below is from the reference sequence of NM_005345. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCAGGCCCCACCATTGAGGAGGTAGATTAGGGGCCTTTCCAAGATTGCTGTTTTTGTTTTGGAGCTTCA
AGACTTTGCATTTCCTAGTATTTCTGTTTGTCAGTTCTCAATTTCCTGTGTTTGCAATGTTGAAATTTT
TTGGTGAAGTACTGAACTTGCTTTTTTTCCGGTTTCTACATGCAGAGATGAATTTATACTGCCATCTTA
CGACTATTTCTTCTTTTTAATACACTTAACTCAGGCCATTTTTTAAGTTGGTTACTTCAAAGTAAATAA
ACTTTAAAATTCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005345.6
Synonyms HEL-S-103; HSP70-1; HSP70-1A; HSP70-2; HSP70.1; HSP70.2; HSP70I; HSP72; HSPA1
Summary This intronless gene encodes a 70kDa heat shock protein which is a member of the heat shock protein 70 family. In conjuction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. It is also involved in the ubiquitin-proteasome pathway through interaction with the AU-rich element RNA-binding protein 1. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which encode similar proteins. [provided by RefSeq, Jul 2008]
Locus ID 3303
MW 11.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...