FBXO2 (NM_012168) Human 3' UTR Clone

CAT#: SC204184

3' UTR clone of F-box protein 2 (FBXO2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FBXO2 (NM_012168) Human 3' UTR Clone
Vector pMirTarget
Synonyms FBG1; Fbs1; FBX2; NFB42; OCP1
ACCN NM_012168
Insert Size 337 bp
Sequence Data
>SC204184 3’UTR clone of NM_012168
The sequence shown below is from the reference sequence of NM_012168. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCAACAGCAGCGTGTGGGTAGAACCCTGAGCGACCCTGCCTCCACTCTCCCCCAGCTGCCTGGAGGGG
CAAAGGTCGAGGGTAGATAGGCCTTAACTTAGTCCATAGCGTCCTCACCTTCCCCAAGCCACACATCCT
CCTCCCATCCCTTGCTCCGATCCCAGCCCCTGAGCAGGGAGAGAGAAGTTTTGTTGGCATAGGTTTGCT
TAGGTAGCCGGCTTCTAGAATGTAGATCCGTGAGGGCGTGAGCTTGGACTGGACCCACTGCTGATTCCC
TGCACCTAGCACAGTGCTTGCCACAAAGTGGGCTCTCAATAAATATTATTTGTCCAAGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012168.6
Synonyms FBG1; Fbs1; FBX2; NFB42; OCP1
Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. This protein is highly similar to the rat NFB42 (neural F Box 42 kDa) protein which is enriched in the nervous system and may play a role in maintaining neurons in a postmitotic state. [provided by RefSeq, Jul 2008]
Locus ID 26232
MW 12.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...