MMP3 (NM_002422) Human 3' UTR Clone

CAT#: SC204366

3' UTR clone of matrix metallopeptidase 3 (stromelysin 1 progelatinase) (MMP3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 2 publications.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MMP3 (NM_002422) Human 3' UTR Clone
Vector pMirTarget
Synonyms CHDS6; MMP-3; SL-1; STMY; STMY1; STR1
ACCN NM_002422
Insert Size 355 bp
Sequence Data
>SC204366 3’UTR clone of NM_002422
The sequence shown below is from the reference sequence of NM_002422. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGAAGAGTAACAGCTGGCTTAATTGTTGAAAGAGATATGTAGAAGGCACAATATGGGCACTTTAAATG
AAGCTAATAATTCTTCACCTAAGTCTCTGTGAATTGAAATGTTCGTTTTCTCCTGCCTGTGCTGTGACT
CGAGTCACACTCAAGGGAACTTGAGCGTGAATCTGTATCTTGCCGGTCATTTTTATGTTATTACAGGGC
ATTCAAATGGGCTGCTGCTTAGCTTGCACCTTGTCACATAGAGTGATCTTTCCCAAGAGAAGGGGAAGC
ACTCGTGTGCAACAGACAAGTGACTGTATCTGTGTAGACTATTTGCTTATTTAATAAAGACGATTTGTC
AGTTATTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002422.5
Synonyms CHDS6; MMP-3; SL-1; STMY; STMY1; STR1
Summary Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. This gene encodes an enzyme which degrades fibronectin, laminin, collagens III, IV, IX, and X, and cartilage proteoglycans. The enzyme is thought to be involved in wound repair, progression of atherosclerosis, and tumor initiation. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. [provided by RefSeq, Jul 2008]
Locus ID 4314
MW 13.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Documents

Customer Reviews 
Loading...