PSMA1 (NM_148976) Human 3' UTR Clone

CAT#: SC204576

3' UTR clone of proteasome (prosome macropain) subunit alpha type 1 (PSMA1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PSMA1 (NM_148976) Human 3' UTR Clone
Vector pMirTarget
Synonyms HC2; HEL-S-275; NU; PROS30
ACCN NM_148976
Insert Size 346 bp
Sequence Data
>SC204576 3’UTR clone of NM_148976
The sequence shown below is from the reference sequence of NM_148976. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAAAGGCTGATGAACCAATGGAACATTAAGTGATAAGCCAGTCTATATATGTATTATCAAATATGTAA
GAATACAGGCACCACATACTGATGACAATAATCTATACTTTGAACCAAAAGTTGCAGAGTGGTGGAATG
CTATGTTTTAGGAATCAGTCCAGATGTGAGTTTTTTCCAAGCAACCTCACTGAAACCTATATAATGGAA
TACATTTTTCTTTGAAAGGGTCTGTATAATCATTTTCTAGAAAGTATGGGTATCTATACTAATGTTTTT
ATATGAAGAACATAGGTGTCTTTGTGGTTTTAAAGACAACTGTGAAATAAAATTGTTTCACCGCCTGGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_148976.3
Synonyms HC2; HEL-S-275; NU; PROS30
Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Locus ID 5682
MW 13.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...